Desulfurococcus is a genus of archaeans in the family Desulfurococcaceae. See the NCBI webpage on Desulfurococcus. Data extracted from the "NCBI taxonomy...
2 KB (176 words) - 03:14, 11 May 2025
sulphur-dependent organisms related to the genera Sulfolobus, Pyrodictium and Desulfurococcus. They are hydrogen-sulphur autotrophs and can grow at temperatures...
7 KB (588 words) - 16:11, 6 December 2024
with high salinity. In other Archaea, such as Methanomicrobium and Desulfurococcus, the wall may be composed only of surface-layer proteins, known as...
43 KB (4,789 words) - 21:03, 22 June 2025
Desulfurococcaceae Zillig & Stetter 1983 Genera Aeropyrum Caldococcus Desulfurococcus Ignicoccus Ignisphaera Staphylothermus Stetteria Sulfophobococcus Thermodiscus...
6 KB (232 words) - 16:19, 6 December 2024
enzymes I-DmoI (P21505) and I-CreI (P05725), taken respectively from Desulfurococcus mobilis and Chlamydomonas reinhardtii. Homing endonucleases differ...
24 KB (2,573 words) - 14:10, 31 October 2024
algae Chlamydomonas reinhardtii) and I-DmoI (from the archaebacterium Desulfurococcus mobilis). The best known LAGLIDADG endonucleases are homodimers (for...
20 KB (2,295 words) - 10:15, 4 July 2022
microorganism must be present to remove hydrogen. Some microorganisms, such as Desulfurococcus amylolyticus, are able to convert formate into carbon dioxide, acetate...
18 KB (1,858 words) - 03:29, 20 December 2024
Zillig & Stetter 1983 ?Caldococcus Aoshima, Yamagishi & Oshima 1996 Desulfurococcus Zillig & Stetter 1983 Staphylothermus Stetter & Fiala 1986 ?Sulfophobococcus...
92 KB (4,433 words) - 13:43, 10 June 2025
aggregans, Caldisphaera lagunensis, Acidilobus saccharovorans, and Desulfurococcus kamchatkensis. F. fontis is distinguished from its relatives due to...
17 KB (1,835 words) - 19:47, 19 June 2025
the group Crenarchaeota and closely related to Staphylothermus and Desulfurococcus. List of Archaea genera See the NCBI webpage on Thermosphaera. Data...
4 KB (376 words) - 01:10, 11 December 2024
of the anaerobic, protein-degrading hyperthermophilic crenarchaeon Desulfurococcus kamchatkensis". Journal of Bacteriology. 191 (7): 2371–9. doi:10.1128/JB...
82 KB (4,421 words) - 19:11, 18 August 2024
extreme thermophiles. Desulfurococcaceae share the same family as Desulfurococcus. Two species of Staphylothermus have been identified: S. marinus and...
9 KB (1,029 words) - 21:12, 12 May 2025
GACAGTTTGG--- 3' 3' ---GACCCAAGTTTTGCAG CACTCTGTCAAACC--- 5' I-DmoI H1 1B24 Desulfurococcus mobilis A chrm 5' ATGCCTTGCCGGGTAAGTTCCGGCGCGCAT 3' TACGGAACGGCCCATTCAAGGCCGCGCGTA...
37 KB (2,374 words) - 23:23, 19 January 2023
rifampicin. Its RNA polymerase does not react with antibodies against Desulfurococcus RNA polymerase. It has a GC-content of 41.0 ± 0. 2 mol%. Due to its...
8 KB (990 words) - 00:19, 2 April 2025