Bacteriophage T7 (or the T7 phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of Escherichia coli and relies on these...

initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7   TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA...

bacteriophages used in phage display are M13 and fd filamentous phage, though T4, T7, and λ phage have also been used. Phage display was first described...

T7 or T-7 may refer to: Thoracic vertebra 7 Thoracic spinal nerve 7 T7 phage, a virus used in the study of biological systems T7 DNA Helicase, a hexameric...

possesses a gene that is expressed to produce T7 RNA polymerase. (This polymerase originates from the T7 phage, a bacteriophage virus which infects E. coli...

186 phage λ phage Φ6 phage Φ29 phage ΦX174 Bacteriophage φCb5 G4 phage M13 phage MS2 phage (23–28 nm in size) N4 phage P1 phage P2 phage P4 phage R17...

bacteriophages. For example, T7 phages have two operons. The first operon codes for various products, including a special T7 RNA polymerase which can bind...

infectious phage made. Proteases have been evolved to cut different peptides using PACE. In these systems, the desired protease cut site is used to link a T7 RNA...

Teseptimavirus (synonyms T7 phage group, T7-like phages, T7-like viruses, T7likevirus) is a genus of viruses in the order Caudovirales, in the family Autographiviridae...

Filamentous phages retard bacterial growth but, contrasting with the lambda phage and the T7 phage, are not generally lytic. Helper phages are usually...

Nucleotidyl transfer by DNA polymerase. T7 DNA polymerase catalyzes the phosphoryl transfer during DNA replication of the T7 phage. As shown in Figure 2, the 3’...

T7 phage in structure though the two viruses may differ in capsid maturation. FRASER, D; WILLIAMS, RC (Feb 1953). "Details of frozen-dried T3 and T7 bacteriophages...

The T7 Holin family (TC# 1.E.6) is a member of the Holin Superfamily II. Members of this family are predominantly found in Caudovirales and Pseudomonadota...

T7 DNA helicase (gp4) is a hexameric motor protein encoded by T7 phages that uses energy from dTTP hydrolysis to process unidirectionally along single...

GP5 could refer to several things: GP5 (gene) T7 phage, or Gp5 GP5 chip, computer chip GP-5 gas mask, Soviet civilian gas mask This disambiguation page...

Bacteriophages (phages), potentially the most numerous "organisms" on Earth, are the viruses of bacteria (more generally, of prokaryotes). Phage ecology is...

promoter and sequence which corresponds to the mRNA construct. By combining T7 phage RNA polymerase and the plasmid DNA, the mRNA can be transcribed in the...

DnaG primases can have extra functions, if given the right domains. The T7 phage gp4 is a DnaG primase-helicase fusion, and performs both functions in replication...

event and planetary ejection Atmospheric reentry Simulated conditions T7 phage Canine hepatitis Influenza PR8 Tobacco mosaic virus Vaccinia virus Yeast...

Twinkle is a mitochondrial protein with structural similarity to the phage T7 primase/helicase (GP4) and other hexameric ring helicases. The twinkle...

from Dartmouth College in 1997 for his work on genetic engineering using T7 phage. Endy was a junior fellow for 3 years and later an Assistant Professor...

virion include bacteriophages λ and Ε34. Many Podoviridae, for example phages T7 and Φ29, share few DNA similarities with P22, even though their virion...

when resistance is forced by mutagenesis experiments. Double-stranded DNA phage lysins tend to lie within the 25 to 40 kDa range in terms of size. A notable...

and cloning vectors in E. coli include plasmids, bacteriophages (such as phage λ), cosmids, and bacterial artificial chromosomes (BACs). Some DNA, however...

(Bacillus subtilis). PUR (ROSE-8), study of space environment effect on T7 phage, its DNA and of polycristalline uracil. IMBP (Institute of Biomedical Problems)...

specifically the phage T7 gene 5 protein, under the control of the T7 RNA polymerase promoter. During this process, Richardson constructed a T7 phage with deletions...

environment and mutation severity as revealed by in silico mutagenesis of phage T7. Genetics. 160:1273-1281. Schuppli, D., J. Georgijevic, and H. Weber. 2000...

small family that includes members derived from a number of Burkholderia phage as well as a Poloromonas species. As of April 3, 2016, this family belongs...

needed] Exposure of bacteriophage (phage) T4 to ultraviolet irradiation induces thymine dimers in the phage DNA. The phage T4 denV gene encodes endonuclease...

effect of differential methylation by Escherichia coli of plasmid DNA and phage T7 and λ DNA on the cleavage by restriction endonuclease MboI from Moraxella...